Study on Determination of Mutations of the PTEN Tumor Suppressor Gene in Various Cancer Types

 

Nesrin Turaçlar1*, Şahande Elagöz2 and Hasibe Cingilli Vural3

1Vocational School of Health Services, Selcuk University, Konya, Turkey

2Department of Pathology, Cumhuriyet Medical Faculty, Cumhuriyet University, Sivas, Turkey

3Selcuk University, Department of Biology, Molecular Biology, 42079 Selçuklu, Konya, Turkey

*Corresponding Author E-mail: drnesrinturaclar@yahoo.com

 

 

ABSTRACT:

Among all tumours diagnosed worldwide, gastric adenocarcinoma, breast and endometrium are the most frequent types of malignancy. In addition to these cancer types, PTEN frequently is mutated or inactivated in glioblastoma, melanoma, and cancers of the prostate. The severity of PTEN irregularities strongly correlates with the tumor stage and grade. For example, complete loss of PTEN expression is found more frequently in metastatic cancer than in primary tumors. For this reason, the aim of this study was to assess the contribution of PTEN gene to commonly cancer types in the Turk population and investigate mutation of tumor suppressor gene PTEN in gastric cancer, breast cancer and endometrium cancer types. In our study, DNA was obtained from different tissue types such as, gastric adenocarcinoma, breast and endometrium cancer samples, amplified, screened for 2 exons (exon 1 and exon 2) of the PTEN gene by PCR-SSCP and then confirmed by sequencing. There was only one sample that presented an alteration and that was a transversion. Our results corroborate the hypothesis that somatic alterations in the PTEN gene are rare events in gastric cancer. Furthermore, Inherited changes in several other genes, including PTEN have been found to increase the risk of developing breast cancer and endometrium cancer. This case affirmed that, for establishment of a correct diagnosis, especially for rare clinically overlapping syndromes, molecular testing is usually the only reliable method.

 

KEYWORDS: PTEN, Cancer types, mutation, SSCP, PCR

 


 

INTRODUCTION:

PTEN is a tumor suppressor gene located at human chromosome 10q23 that encodes a dual substrate-specific phosphatase. This gene is frequently deleted or mutated in a wide range of human tumors and tumor cell lines. Allelic losses and somatic mutations at the PTEN locus are present in aggressive brain tumors, endometrial and breast cancers and melanomas, reiterating its role as a tumor suppressor gene. Allelic losses at 10q23.3 in breast cancers have been correlated with an increased incidence of lymph node metastases, and poor histologic grade. A candidate tumor suppressor gene PTEN (also known as MMAC1 or TEP1) has recently been isolated from chromosome 10q23.3 (1-4,16,24-27,30,31). They are found mutated in several cancer types that display LOH in this region(5-12).

 

The PTEN gene encodes a 403 amino acid protein homologous to some protein phosphatases, and the protein has been shown to possess protein phosphatase activity in vitro(12-14).It is thought that PTEN protein dephosphorylates the 3 positions of phosphatidylinositol 3,4,5-triphosphate (PIP3), a well-known intracellular messenger of certain cell-growth stimulators(15,16). The molecular mechanisms of PTEN have been elucidated recently, and it is considered that PTEN belongs to a class of tumor suppressor genes together with p53, Rb, and APC.

 

It is thus far the most frequently mutated gene and its mutation is associated with tumorigenesis in the gastric cancer, breast cancer and endometrium cancer types. Hence, different cancer specimens were selected to probe PTEN gene mutations in genome of gastric cancer, breast cancer and endometrium and paracancerous tissues using PCR-SSCP-DNA sequencing method based on microdissection and to observe the protein expression by immunohistochemistry technique (22).

 


 

Table 1. Patients with various cancer risks were analyzed with respect to the histologic diagnoses.

Tissue

Histopatolojik diagnosis

Numbers of samples

Stage

TNM

Breast

Apocrine CA

6

IIA

T2N0MX

Breast

Apocrine CA

6

I

T1N0MX

Breast

Mix invasive ductal+lobular CA

3

IIIA

T3N2MX

Breast

Invasive ductal CA

10

IIA

T2N0MX

Breast

Invasive ductal CA

6

I

T1N0MX

Breast

Invasive ductal CA

9

IIA

T1N1MX

Breast

Invasive ductal CA

3

IIIA

T2N2aMx

Breast

Invasive ductal CA

5

IIA

T2N0Mx

Breast

Invasive ductal CA

8

IIIC

T3N3Mx

Breast

Inflammatory CA

6

IIIB

T4dN2Mx

Breast

Invasive lobular CA

7

IIA

T1cN1aMx

Gastric

Neuroendocrine carsinoma

4

IIIA

T3N1Mx

Endometrıum

Adenocarsinoma

7

IB

T1BN0Mx

 

 


Figure 1: Invasive Ductal Carsinom of Breast (HE;X100) histopatolojic

 

To the best of our knowledge, the frequency of altered PTEN in breast and endometrium cancers in Turkish women has not yet been studied. In this study, we aimed to determine the incidence of PTEN loss immunohistochemically in a group of clinically localized gastric, breast and endometrium adenocarcinoma patients from Turkey. Presence of any correlation between PTEN expression and clinicopathological prognostic parameters was also evaluated. Endometrial cancer is the most commonly diagnosed cancer of the female reproductive tract in Turkey and other western countries (23). Although several genes may be altered in these cancers, the molecular events in the development of endometrial carcinoma remain poorly defined.


 

Figure 2: Screening of amplification of PTEN Exon 1 using PCR

 

Table 2. PCR primers of PTEN gene exon 1 and 2 including locales and annealing Tm values of these primers.

No

Exon

Locus

Sequence of Primers

Amplified Fragments (bp)

Tm (oC)

1

2

PTEN-Ex2-F

PTEN-Ex2-R

TGACCACCTTTTATTACTCCA

TACGGTAAGCCAAAAAATGA

367

60

2

1

PTEN-Ex1-F

PTEN-Ex1-R

TCTGCCATCTCTCTCCTCCT CCGCAGAAATGGATACAGGT

177

60.5

 


MATERIAL AND METHOD:

Cases

We enrolled 80 incident different cancer cases and 100 healthy controls in this study. Tissue samples were also collected at the same time as the blood samples for control and were processed within 5 h of collection. The study was approved by the medical ethics board of Cumhuriyet University, Sıvas, Turkey.

 

Histopathology study

In the research ,(from 2002 to 2008) 80 new cases which were sent to Cumhuriyet University Medical Faculty, Department of Pathology, with the prediagnosis of malign tumors and whose fresh tissue samples had been investigated were started to be studied. Fresh tissue samples about 3 mm. were taken from the tumoral pieces aiming to have molecular genetic analysis and they were put into deep freezer (at -20 şC).

 

For histopathologic investigation, tissues were fixed in %10 formal and were embedded in parafine, then were prepared in 5 µm cross sections and they were painted with rutine haematoxylin-eosin dye. The sample histopathological images of different cancer types (stained using hematoxylin-and-eosin technique) are shown in Figure 2 and Table 1.

 

 

Patients and DNA isolation

The DNA used for polymorphic analysis was isolated from the biopsy samples of patients with cancers by using DNA isolation kit purchased from nucleic acid isolation kit (Oiagen, Almanya) the manufacturer’s instructions (Figure 1). Isolated DNA was stored at –20 °C till use. The control group consisted of healthy unrelated volunteers without a medical history of cancer or other chronic diseases. All patients and controls were of Turkish population.

 

PCR amplification of sequence of exons 1 and 2 in PTEN gene

For polymerase chain reaction (PCR) application (Archeametry and Biotechnology Laboratory, Turkey), increasing concentrations of extracted DNA of each specimen was tested to find out the optimum dose that resulted in good amplicon product. Exon 1 and Exon 2 of the PTEN gene were amplified using primer designed according to Risinger et al (13, 14). Each primer pairs of the selected exons was used for mutation detection of PTEN/MMAC1 following the PCR for the single-strand conformation polymorphism (PCR-SSCP). The PCR protocol was carried out as outlined in Table 2, Tm values or annealing Tm and primers used for each PTEN exon were as follows:

 

4 µl each cancer tissue genomic DNA was amplified in a mixture composed of 5 μl 10XPCR Taq buffer (pH 8.8), 2 mM MgCl2, and 10 mM dNTPs (dGTP, dATP, dTTP, dCTP) at each, 0.5 mM of each primer, and 0.3 U DreamTaq polymerase (Advanced Biotechnologies Ltd., Fermantase Life Science).


 

Figure 3: PCR-SSCP showing exons 1 (A) and 2 (B) in PTEN gene.

 

 


Amplification was submitted to polymerase chain reaction for exon1; Initial denaturation at 94 °C 4 min, denaturation at 94 °C 1 min, annealing Tm at 60,5 °C 1 min, extension at 72 °C 15 s, total 30 cycles and final extension at 72 °C 3 min. As for exon 2 PCR amplification conditions; initial denaturation at 94 °C 4 min, denaturation at 94 °C 15 s, annealing Tm at 60 °C 30 s, extension at 72 °C 15 s following 10 cycles and at 94 °C 15 denaturation, at 58 °C 20 s annealing, at 72 °C 15 s extension and 20 cycles, end step at 72 °C 3 min final extension. For this exon 2 reaction was effected as two progressive. PCR was done on genomic DNA extracted from whole blood and the other tissue samples using suitable primers to amplify these loci. Amplified PCR products were screened for genotyping of loci by SSCP (single stranded conformation polymorphism) using non-radioactive method. PCR products were separated by electrophoresis on 2 % agarose gel in 1XTAE buffer (45Mm Tris, 1mM EDTA, pH 8), stained with ethidium bromide. In order to avoid non-specific reactions, PCR mixture should be prepared and maintained under cool conditions (4 oC) (Figure 3 and 4).

 

SSCP analysis

Eight percent neutral polyacrylamide gel electrophoresis was performed as previously described [16]. In brief, 3 mL 40% acrylamide solution, 3 mL 5XTBE solution, 3 mL 50% glycerin, 6 mL ddH2O, 75 μL 10% ammonium presulfate, 7 μL TEMED, were blended adequately and poured into the gel, then concreted for 1 h at room temperature. Four μL PCR products and 6 μL for- mamide sample were mixed. The mixture was centrifuged for 15 s, denatured at 95 oC for 10 min, bathed in ice for 10 min, put on an 8% neutral polyacrylamide gel, and electrophoresed with 1XTBE buffer for 8 h at 300 V. The fixation solution was infused into a flat utensil, into which gel was immerged, vibrated for 10 min, and washed 3 times (2 min each time) with ddH2O. The gel was immerged into a staining solution, vibrated for 10 min, washed 3 times (20 s each time) with ddH2O. The gel was then immerged into a display solution, vibrated until the sample signal became brown and the background became transparent yellow, and rinsed with tap water to stop display. The staining results were observed and photographs were taken. According to the PCR-SSCP results of genome DNA, the difference in the single strand strip number and electrophoresis transference location, also known as the mobility shift, was considered PCR-SSCP positive.

 

Statistical analysis

Fisher’s exact probability and chi-square test were used in statistical analysis. P<0.05 was considered statistically significant.

 

RESULTS AND DISCUSSION:

PTEN is a crucial negative regulator of breast tumorigenesis and loss of PTEN is associated with a poor outcome of breast cancer (30,32). PTEN is one of the important factors controlling mammary epithelial cells during normal mammary gland development and mammary gland cycling (33). Epithelial ovarian tumors exist as four major histologic types (endometrioid, serous, mucinous, and clear cell), which probably evolve via distinct molecular pathways. Analysis of all four histologic types of ovarian tumors for the loss of heterozygosity on chromosome 10 and mutations in the PTEN/MMAC1 gene indicated that the gene is mutated predominantly, if not exclusively, in ovarian tumors of endometrioid origin (17, 18). Thus, an important observation is that PTEN/MMAC1 mutations are common in endometrial as well as ovarian tumors of endometrioid histology and that tumors of both types containing such mutations are well or moderately differentiated, suggesting the involvement of PTEN/MMAC1 tumor suppressor function in disease initiation.

 

PTEN/MMAC1 was originally isolated from a region homozygously deleted in several cancer cell lines, including gastric carcinoma and cancers of the breast and endometrium. Mutations in this gene have been reported as endometrial carcinoma, breast tumors, and malignant melanoma. Germ-line mutation of PTEN/MMAC1 is also associated with two autosomal dominant disorders belonging to the family of hamartomous polyposis syndrome(7,19,28-29). Thus some cancers seem devoid of PTEN/MMAC1 alterations (e.g. serous carcinoma of endometrium and cervical cancer). Genetic changes of PTEN/MMAC1 occur in multiple types of cancer, suggesting that inactivation of PTEN/MMAC1 may play an important but perhaps somewhat general role in the pathogenesis of a variety of human malignancies (20, 21). Studies suggest that PTEN may be the most frequently mutated gene in prostate cancer and in cancer of the uterine lining (endometrial cancer). PTEN mutations also have been identified in several other types of cancer, including certain aggressive brain tumors (glioblastomas and astrocytomas) and an aggressive form of skin cancer called melanoma. Mutations in the PTEN gene result in an altered enzyme that has lost its tumor suppressor function. The loss of this enzyme likely permits certain cells to divide uncontrollably, contributing to the growth of cancerous tumors. In some cases, the presence of PTEN mutations is associated with more advanced stages of tumor growth.

 

Based on the findings from this study, we conclude that PTEN the mutation rates are lower in gastric cancer compared with that in the other endometrium, breast cancers. In this study, we investigated PTEN gene mutations in 10 primary gastric cancers and other cancer types by polymerase chain reaction single strand conformation polymorphism (PCR-SSCP). No mutations were detected in any of the tissue with cancers. Therefore, we conclude that PTEN does not participate in gastric carcinogenesis as a tumor suppressor gene. Our results corroborate the hypothesis that somatic alterations in the PTEN gene are rare events in gastric cancer. Furthermore, Inherited changes in several other genes, including PTEN have been found to increase the risk of developing breast cancer and endometrium cancer. This case affirmed that, for establishment of a correct diagnosis, especially for rare clinically overlapping syndromes, molecular testing is usually the only reliable method.

 

Detection of the PTEN gene exons 1-2 of genome DNA in different cancer types and paracancerous tissue samples indicated that the amplified PCR product had no gene homozygous alteration and no large and/or alteration in the alleles. Ten μL reaction product of PCR amplified exon 1 and 2 Taq I enzyme cut reaction on a 2% agarose gel containing 0.5 g/L EB, 100 bp DNA ladder were used as a standard reference. The results indicated that the number and size were in accordance with the theory. The 281 bp, 247 bp, 30 bp segments were relatively justified as the complete enzyme cut reaction. As for the SSCP detection of the survey there was no abnormal SSCP strip in exons 1 and 2.

 

ACKNOWLEDGMENT:

We are grateful to Dr. Şahande Elagöz for assistance in obtaining the clinical material used in this study and to Dr. Hasibe Cingilli VURAL for her support of this research program.

 

ABBREVIATIONS:

LOH, loss of heterozygosity; PTEN, phosphatase and tensin homolog deleted on chromosome ten; MMAC1, mutated in multiple advanced cancers 1.

 

REFERENCES:

1.       Li J, Yen C, Liaw D, et al., 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science  275: 1943-7.

2.       Tamura M, Gu J, Takino T, Yamada KM., 1999  Tumor suppressor PTEN inhibition of cell invasion, migration, and growth: differential involvement of focal adhesion kinase and p130Cas. Cancer Res 59: 442-9.

3.       Eric D. Lynch,, Elizabeth A. Ostermeyer,Ming K. Lee, et all., 1997 Inherited Mutations in PTEN That Are Associated with Breast Cancer,Cowden Disease, and Juvenile Polyposis. Am. J. Hum. Genet. 61:1254–1260.

4.       Cantley LC, Neel BG., 1999 New insights into tumor suppression: PTEN suppresses tumor formation by restraining the phosphoinositide 3-kinase/AKT pathway. Proc Natl Acad Sci USA  96:4240 –5.

5.       Jones MH, Koi S, Fujimoto I, Hasumi K, Kato K, Nakamura Y ., 1994 Allelotype of uterine cancer by analysis of RFLP and microsatellite polymorphisms: frequent loss of heterozygosity on chromosome arms 3p, 9q, 10q, and 17p. Genes Chromosom Cancer 9:119–123

6.       Zedenius J,Wallin G, Svensson A, Bovee J, Hoog A, Backdahl, Larsson C .,1996 Deletions of the long arm of chromosome 10 in progression of follicular thyroid tumors. Hum Genet 3:299–303

7.       Bose S, Wang SI, Terry MB, Hibshoosh H, Parsons R., 1998 Allelic loss of chromosome 10q23 is associated with tumor progression in breast carcinomas. Oncogene  17:123-127

8.       Singh B, Ittmann MM, Krolewski JJ., 1998 Sporadic breast cancers exhibit loss of heterozygosity on chromosome segment 10q23 close to the Cowden disease locus. Genes Chromosomes Cancer 21:166-171

9.       Garcia JM, Silva JM, Dominguez G, Gonzalez R, Navarro A, Carretero L, Provencio M, Espana P, Bonilla F., 1999 Allelic loss of the PTEN region (10q23) in breast carcinomas of poor pathophenotype. Breast Cancer Res Treat  57:237-243

10.     Feilotter HE, Coulon V, McVeigh JL, Boag AH, Dorion-Bonnet F, Duboue B, Latham WC, Eng C, Mulligan LM, Longy M.,1999 Analysis of the 10q23 chromosomal region and the PTEN gene in human sporadic breast carcinoma. Br J Cancer  79:718-723

11.     Perren A, Weng LP, Boag AH, Ziebold U, Thakore K, Dahia PL, Komminoth P, Lees JA, Mulligan LM, Mutter GL, Eng C., 1999 Immunohistochemical evidence of loss of PTEN expression in primary ductal adenocarcinomas of the breast. Am J Pathol 155:1253-1260

12.     Laura Simpson and Ramon Parsons., 2001 PTEN: Life as a Tumor Suppressor.  Experimental Cell Research 264, 29–41

13.     Risinger, J. I., Hayes, A. K., Berchuck, A., and Barrett, J. C., 1997 PTEN/MMAC1 mutations in endometrial cancers. Cancer Res. 57: 4736-4738.

14.     Sakurada, A., Suzuki, A., Sato, M., Yamakawa, H., Orikasa, K., Uyeno, S., Ono, T., Ohuchi, N., Fujimura, S., and Horii, A., 1997 Infrequent genetic alterations of the PTEN/MMAC1 gene in Japanese patients with primary cancers of the breast, lung, pancreas, kidney, and ovary. Jpn. J. Cancer Res. 88: 1025-1028.

15.     B. Kwabi-Addo, D. Giri, K. Schmidt, K. Podsypanina, R. Parsons, N. Greenberg, M. Ittmann., 2001  Haploinsufficiency of the PTEN tumor suppressor gene promotes prostate cancer progression, Proc. Natl Acad. Sci. USA. 98: 11563-11568.

16.     Kazuki Ueda,1, 2 Misae Nishijima,1 Hiroki Inui,et all., 1998 Infrequent Mutations in the PTEN/MMAC1 Gene among Primary Breast Cancers. Jpn. J. Cancer Res. 89, 17–21, January

17.     Obata K, Morland SJ, Watson RH, Hitchcock A, Chenevix-Trench G, Thomas EJ, et al., 1998 Frequent PTEN/MMAC mutations in endometrioid but not serous or mucinous epithelial ovarian tumors. Cancer Res 58: 2095–7.

18.     Yokomizo A, Tindall DJ, Hartmann L, Jenkins RB, Smith DI, Liu W., 1998 Mutation analysis of the putative tumor suppressor PTEN/MMAC1 in human ovarian cancer. Int J Oncol 13:101–5.

19.     Casey G., 1997  The BRCA1 and BRCA2 breast cancer genes. Curr Opin Oncol 9:88–93 .

20.     Dahia PL, Marsh DJ, Zheng Z, Zedenius J, Komminoth P, Frisk T, et al., 1997 Somatic deletions and mutations in the Cowden disease gene, PTEN, in sporadic thyroid tumors. Cancer Res 57:4710–3.

21.     X.P. Zhou, K.A. Waite, R. Pilarski, H. Hampel, M.J. Fernandez, C. Bos, et al., 2003 Germline PTEN promoter mutations and deletions in Cowden/Bannayan-Riley-Ruvalcaba syndrome result in aberrant PTEN protein and dysregulation of the phosphoinositol-3-kinase/Akt pathway, Am J. Hum. Genet. 73: 404-411.

22.     Shuxia Li, Jiawei Chen, Zhaorui Yang, Guangzhong Lu, Huamei Tang & Honghui Hu., 2008 N-myc downstream-regulated gene 1 as a downregulated target gene of PTEN in the controlling of tumourigenesis in endometrioid carcinoma. Indian J Med Res 127,  pp 453-459

23.     Ayse Ayhan, M.D., Ekrem C. Tok, Ibrahim Bildirici, and Ali Ayhan., 2001 Overexpression of CD44 Variant 6 in Human Endometrial Cancer and Its Prognostic Significance .Gynecologic Oncology 80, 355–358

24.     Li, D. M. and Sun, H., 1997   TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer Res. 57, 2124-2129.

25.     25.Li, J., Yen, C., Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J.,Miliaresis, C., Rodgers, L., McCombie, R. et al., 1997 PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, andprostate cancer. Science. 275, 1943-1947.

26.     Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon,A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T. et al., 1997 Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat.Genet. 15, 356-362.

27.     Dahia, P. L., 2000 PTEN, a unique tumor suppressor gene. Endocr. Relat. Cancer  7, 115-129.

28.     28.Nelen MR, Padberg GW, Peeters EAJ, et al., 1996 Localization of the gene for Cowden disease to chromosome 10q22-23. Nat Genet 13:114-16.

29.     Liaw D, Marsh DJ, Li J, et al., 1997 Germline mutations of the PTEN gene in Cowden disease, an inherited breast and thyroid cancer syndrome. Nat Genet 16:64-7.

30.     Lu Y, Lin YZ, LaPushin R et al.,1999 The PTEN/MMAC1/TEP tumor suppressor gene decreases cell growth and induces apoptosis and anoikis in breast cancer cells. Oncogene  18: 7034–7045.

31.     Tanaka M, Koul D, Davies MA et al., 2000 MMAC1/PTEN inhibits cell growth and induces chemosensitivity to doxorubicin in human bladder cancer cells. Oncogene  19: 5406–5412.

32.     Depowski, P. L., Rosenthal, S. I. and Ross, J. S., 2001  Loss of expression of the PTEN gene protein product is associated with poor outcome in breast cancer. Mod. Pathol. 14, 672-676.

33.     Gang Li, Gertraud W. Robinson, Ralf Lesche, et all.; Conditional loss of PTEN leads to precocious development and neoplasia in the mammary gland. Development 2002;129, 4159-4170.

 

 

 

Received on 20.12.2011         Modified on 30.12.2011

Accepted on 15.01.2012         © AJRC All right reserved

Asian J. Research Chem. 5(3):  March 2012; Page 371-376